B6-Ly5.2 (CD45.1) mice were from the Jackson Laboratory. Tcf7⁻ (7), Tcf7^YFP (2), Lat⁻ (10), Vav1-iCre (11), Gata3^flox (12) mouse strains have previously been described. Microinjections for Tcf7^{Δ1−2/Δ1−2}, Tcf7^Δ1/Δ1, Tcf7^Δ2/Δ2, Tcf7^Δ3/Δ3, and Tcf7^Δ4/Δ4 mice were performed on B6 zygotes by co-injecting CRISPR/Cas9 sgRNAs, which flanked either end of each of the deleted regions. Tcf7^{Δ1−2/Δ1−2}, Tcf7^Δ1/Δ1, and Tcf7^Δ2/Δ2 mice were generated by co-injecting three sgRNAs (guide-1: chr11:52299410-52299431, guide-2: chr11:52306970-52306989, guide-3: chr11:52318934-52318955 on mm10). Cuts made by Guide-1 and Guide-3 resulted in deletion of the entire 20 kb region in Tcf7^Δ1−2 mouse strains; cuts made by Guide-1 and Guide-2 resulted in deletion of the first 8 kb in Tcf7^Δ1 mouse strains; and cuts made by Guide-2 and Guide-3 resulted in deletion of the last 12 kb in Tcf7^Δ2 mouse strains. Tcf7^Δ3 mice were generated by co-injection of two sgRNAs, Guide-3a (chr11: 52313783-52313802) and Guide-3b (chr11: 52314813-52314831). Tcf7^Δ4 mice were generated by co-injection of two sgRNAs, Guide-4a (chr11: 52318337-52318356) and Guide-4b (chr11: 52318905-52318923). Tcf7^NBS mice were generated by microinjection of a single sgRNA (Guide-NBS, chr11: 52314396-52314414) and a 57bp oligonucleotide patch (GAGCATTCTCAGCAGCAGACCCGAGACGTAGTAGCGGCCGCACACGCCACCTTCATA), containing a NotI restriction enzyme site in place of the original NOTCH motif. All CRISPR/cas9 mice were backcrossed to C57BL/6 mice for two (for Tcf7^{Δ1−2/Δ1−2}, Tcf7^Δ1/Δ1, Tcf7^Δ2/Δ2, Tcf7^Δ3/Δ3, and Tcf7^Δ4/Δ4 mice) or four generations (for Tcf7^NBS/NBS mice). To control for off target effects, we compared littermate controls for all new mouse lines to age-matched WT C57BL/6 mice. We found that thymus size, TCF-1 expression in thymocytes, and TCF-1 expression in ILC precursors were similar for all littermate controls and WT C57BL/6 mice. For each deletion, thymus size, TCF-1 expression in thymocytes, and TCF-1 expression in ILC precursors were assessed on 2 or 3 mouse lines generated from independent founders. Figures show the results obtained using one representative mouse line for each deletion. Deletions for these mouse lines were precisely characterized by sequencing the genomic DNA surrounding the enhancer region of interest. The sequences were the following, Tcf7^Δ1−2: …ATGTGGGATTGCTCACGAGACTCTGGCCAAGCACTTAGTG…. (19525bp deletion), Tcf7^Δ2: …GGTAGGTAGGTGCCACCCCTACCTTTTTTAGTAAAAAGCGGACTCTGGCCAAGCAC…. (11971 deletion and 15 bp insertion), Tcf7^Δ3: …TGCTGGGATTAAAGGAATGAGGGCTTGTATAACCTCAGTG…. (1054 bp deletion), Tcf7^NBS: see Figure 7B. Mice used were 6–10 weeks old and of either sex. Animal procedures were approved by relevant NIH Animal Care and Use Committees. Long-term hematopoietic competitive chimeras were generated by reconstituting CD45.1⁺ recipient mice irradiated at 850 rads, with a mixture of CD45.2⁺ donor cells and CD45.1⁺ competitor cells, either Lin^BM− bone marrow (BM) cells or Lin^BM−Sca-1⁺Kit^hi (LSK) cells. Chimeras were analyzed after 12 weeks of reconstitution.

Cell suspensions were incubated with a mix of rat and mouse serum and hamster IgG, before addition of specific antibodies. Antibodies specific for Ly-6D (49H4), B220 (RA3-6B3), CD19. (1D3), Mac-1 (M1/70), Gr-1 (8C5), CD11c (N418), Ter119 (TER119), NK1.1 (PK136), CD3ε. (2C11), CD8α (53-6.72), CD8β (H35-17.2), CD4 (GK1.5), TCRβ (H57), TCRγδ (GL-3), MHC-II (M5/114.15.2), Kit. (2B8), Sca-1 (D7), Thy-1.2 (53-2.1), α4β7 (DATK32), IL-7Rα (A7R34), 2B4 (eBio244F4), CD25 (PC61.5), CD28 (37.51), CD45.1 (A20), CD45.2 (104), and TOX (TXRX10) were from eBioscience, anti-Flt3 (A2F10) was from BD, anti-TCF-1 (C63D9) was from Cell Signaling. The BM lineage “cocktail” (Lin^BM) is a mix of the following antibodies: anti-Ly-6D, B220, CD19, Mac-1, Gr-1, CD11c, Ter119, NK1.1, CD3ε, CD8α, CD8β, CD4, TCRβ, and TCRγδ. The T lineage “cocktail” (Lin^T) is a mix of the following antibodies: anti-B220, CD19, Mac-1, Gr-1, CD11c, Ter119, NK1.1, CD3ε, CD8α, CD8β, TCRβ, and TCRγδ. TCRβ (where specified ic), TOX, and TCF-1 expression were detected by intracellular staining using eBioscience's transcription factor staining buffer set according to the manufacturer's instructions. Live/dead discrimination was performed by staining with DAPI or LIVE/DEAD Fixable Blue (Invitrogen). Samples were acquired using an LSRFortessa flow cytometer (BD) and analyzed using FlowJo software (Tree Star). All analyses are presented on singlet live cells. BM progenitors were sorted using an Aria flow cytometer (BD). Absolute cell counts were obtained using an Accuri C6 plus (BD). Thymocyte populations are defined as followed: Early T cell precursor (ETP) (Lin^T−Kit^hiCD25⁻, see Figure 2A), Double Negative (DN)2 (Lin^T−Kit^hiCD25⁺, see Figure 2A), DN3a (Lin^T−Kit^loCD25⁺CD28^lo), DN3b (Lin^T−Kit^lowCD25⁺CD28^hi), Immature Single Positive (ISP) (CD8α⁺CD4⁻CD3ε⁻), Double Positive (DP) (CD8α⁺CD4⁺), mature CD4 (CD8α⁻CD4⁺TCRβ⁺), mature CD8 (CD8α⁺CD4⁻TCRβ⁺). BM populations are defined as followed: Lymphoid-primed Multipotent Progenitor (LMPP) (Lin^BM−Kit^hiSca-1⁺Flt3^hi), LSK (Lin^BM−Sca1⁺Kit^hi), TCF-1⁺ Early Innate Lymphoid Progenitor (EILP) (Lin^BM−Kit⁺α4β7⁺2B4⁺Thy1.2⁻TCF-1⁺, see Figure 3A), ILC Precursor (ILCP) (Lin^BM−Kit⁺α4β7⁺2B4⁺Flt3⁻Thy1.2⁺IL-7Rα⁺, see Supplementary Figure 2A), ILC2 progenitor (ILC2P) (Lin^BM−Kit⁻2B4^loThy1.2^hiIL-7Rα⁺, see Supplementary Figure 2B) TOX⁺ EILP (Lin^BM−Kit⁺α4β7⁺2B4⁺Thy1.2⁻TOX⁺, see Figure 3E).

Common Lymphoid progenitor (CLP), CD4, ILCP (GSE98662) (13) ATAC-seq data and TCF-1 (GSE46662) (14, 15), RUNX (GSE33653) (16), GATA-3 (GSE31235) (17), Notch1 (GSE61504) (18), and H3K27ac (GSE76031) (19) ChIP-seq data were downloaded from the NCBI SRA database and aligned to mm10 mouse genome using bowtie2 (Version 2.3.4.2). B cells, CLP, ETP, DN3, and cDCs ATAC-seq data were downloaded from ImmGen (GSE100738) (20). Datasets were viewed and analyzed using the UCSC Genome Browser (http://genome.ucsc.edu/) (21) (Figure 1) or IGV (22) (Supplementary Figure 1). Motif analysis was done using the ECR Browser (23).

LMPP were cultured on irradiated OP9 stromal layers expressing the Notch ligand DL1 (24) in α-MEM media (Gibco) supplemented with 20% FBS (Atlanta Biologicals), glutamine (Gibco), penicillin and streptomycin (Gibco), Flt3-L. (10 ng/mL, PeproTech) and IL-7 (5 ng/mL, PeproTech). CD45.2⁺GFP⁻ cells were considered for analysis of hematopoietic cells.

Statistical analysis was performed on groups with limited variance using Excel or Prism. Differences between groups of mice or wells were determined by a two-tailed unpaired Student's t-test. A p of p < 0.05 was considered statistically significant. Sample sizes were empirically determined, no samples or animals were excluded from the analysis, no randomization, or blinding was used.

We wished to identify candidate regulatory regions that might be required for Tcf7 expression in one or several hematopoietic lineages. Assay for transposase accessible chromatin followed by next generation sequencing (ATAC-seq) reveals regions of open chromatin, and thus can be used to identify putative enhancers. Using publicly available ATAC-seq data, we investigated the presence of open chromatin regions in T cell precursors (ETP, DN3), mature T cells (CD4), and ILC precursors (ILCP), which all express Tcf7; and B cells, that lack Tcf7. We additionally examined common lymphoid progenitors (CLP), which lack Tcf7 expression, and can give rise to T cells, B cells, and ILCs. This analysis identified a 20 kb region upstream of the Tcf7 promoter that showed peaks of open chromatin shared by all Tcf7-expressing populations and in a lesser extent CLP, but not B cells (Figure 1A). On the other hand, the Tcf7 super-enhancer previously identified in T cells (25) and located downstream of the region 1-2, presented numerous ATAC-seq peaks that were not shared between Tcf7-expressing populations, and were not specifically present in Tcf7-expressing populations compared to B cells (Supplementary Figure 1). Importantly, most of the ATAC-seq peaks present in region 1-2 were located in highly conserved regions between mouse and human and contained many binding motifs for factors involved in hematopoiesis (Figure 1A, and not shown). Interestingly, one of the conserved ATAC-seq peaks within the 20 kb region contained a single nucleotide polymorphism (rs244689), that is linked to systemic lupus erythematosus (SLE) in Asian populations (Figure 1B) (26).

We further examined whether candidate controllers of Tcf7 bind in the vicinity of the Tcf7 locus. Although Tcf7 controllers are yet to be identified in ILC, many transcription factors have been proposed to act upstream of Tcf7 expression in developing T cells. Tcf7 expression is thought to initiate downstream of Notch1 signaling in T cell precursors (1, 8, 27), and this initiation requires RUNX factors (28). GATA-3 and TCF-1 itself might further contribute to optimal expression of Tcf7 (8, 29). We used publicly available ChIP-seq data for these transcriptional controllers in T-lineage cells, and found that they all bind the 20 kb candidate regulatory region we identified (Figures 1A,B). On the other hand, we did not observe binding for these factors in the Tcf7 super-enhancer (Supplementary Figure 1). Importantly, ChIP-seq peaks for Notch1, TCF-1, RUNX, and GATA-3 (Figure 1B) all co-localized with binding motifs for these factors that were conserved between mouse and human (not shown). We therefore hypothesized that the 20 kb 1-2 region contains regulatory elements important for Tcf7 expression in one or several hematopoietic lineages.

Using CRISPR/Cas9, we generated mice lacking the 20 kb region 1-2, called the Tcf7^Δ1−2 strain. To examine whether the deletion of the region 1-2 affected Tcf7 expression in thymocytes, we first examined T cell development in the Tcf7^{Δ1−2/Δ1−2} mice compared to Tcf7^−/− mice that lack TCF-1 functional protein (7). Similarly to Tcf7^−/− mice, Tcf7^{Δ1−2/Δ1−2} mice presented a reduced frequency of CD4⁺CD8α⁺ DP cells, and total thymocyte numbers were decreased more than 10-fold compared to WT mice (Figure 2A). Early T cell development was particularly disrupted compared to WT cells, as shown by the absence of recognizable Lin^T−Kit^hiCD25⁻ ETP and Lin^T−Kit^hiCD25^hi DN2 subsets and development of aberrant Lin^T−Kit^intCD25^int subsets (Figure 2A).

We next analyzed levels of TCF-1 protein by intracellular staining on thymocytes. TCF-1 was detectably expressed in Tcf7^{Δ1−2/Δ1−2} thymocytes from DN3 onward, although at much lower levels compared to WT (Figure 2B). Dynamic changes in TCF-1 expression were greatly attenuated in Tcf7^{Δ1−2/Δ1−2}, most notably after β-selection when TCF-1 expression normally peaks during T cell development (Figure 2B). Interestingly, TCF-1 expression never reached WT levels, even in peripheral T cell populations (Figure 2B, not shown).

We further wished to examine Tcf7 initiation during T cell development. Dramatic defects in the generation of ETP and DN2 cells in Tcf7^{Δ1−2/Δ1−2} mice prevented direct assessment of TCF-1 expression at these early developmental stages. We therefore examined TCF-1 initiation in Tcf7^{Δ1−2/Δ1−2} T cell precursors in vitro, after culture on stromal layers expressing Notch ligand (OP9-DL1). In this system, WT BM progenitors upregulated TCF-1 by day 5 (Figure 2C) and generated Thy1^hiCD25^hi DN2/DN3 stages T-lineage cells by day 7 (Figure 2D). On the other hand, Tcf7^{Δ1−2/Δ1−2} and Tcf7^−/− progenitors failed to upregulate TCF-1 and to generate DN2/DN3 T-lineage cells, even at later time points in the culture (Figures 2C,D). Altogether, these results indicate that the 20 kb region deleted in Tcf7^{Δ1−2/Δ1−2} mice is required for initiation of Tcf7 expression at early stages of T cell development.

We next asked whether the 20 kb region 1-2 was also important for Tcf7 expression in the ILC lineage. We examined the presence of TCF-1-expressing ILC precursors in the BM of Tcf7^{Δ1−2/Δ1−2} mice (30). The frequency of TCF-1-expressing early innate lymphoid progenitors (EILP) that initiate Tcf7 expression (9) was dramatically decreased in Tcf7^{Δ1−2/Δ1−2} mice compared to WT mice (Figures 3A,B). Frequencies of the later ILC precursors, ILCP (31) and ILC2P (32) were also decreased in Tcf7^{Δ1−2/Δ1−2} mice compared to WT mice, consistent with a defect in Tcf7 expression in the ILC lineage (Figures 3C,D) (2, 3, 6, 9).

To investigate whether ILC precursors still develop in Tcf7^{Δ1−2/Δ1−2} mice but fail to express TCF-1, we visualized EILP using TOX intracellular staining instead of TCF-1 (2). This alternative gating strategy revealed that, similarly to Tcf7^−/− mice, some EILP were still present in Tcf7^{Δ1−2/Δ1−2} mice (Figure 3E), but they lacked TCF-1 expression (Figure 3F). TCF-1 expression was also greatly reduced on the rare ILCP and ILC2P that developed in Tcf7^{Δ1−2/Δ1−2} mice (Figures 3G,H). These results indicate that the 20 kb region deleted in Tcf7^{Δ1−2/Δ1−2} mice is required for initiation of Tcf7 expression at early stages of ILC development.

We additionally examined TCF-1 expression in other hematopoietic lineages. Using a Tcf7-reporter mouse that expresses the Yellow Fluorescent Protein (YFP) downstream of the endogenous Tcf7 gene (2), we found that Tcf7 expression was evident in cDCs present in lymph nodes (LN) but very low in spleen cDCs. Tcf7-expressing cDCs present in LN corresponded to migratory DCs as defined using CD11c and MHC-II expression (33), whereas such cells were almost absent from the spleen (Figure 4A). To examine whether TCF-1 played a role in the development of migratory cDCs, we reconstituted lethally irradiated mice with Lin^BM-depleted BM cells isolated from Tcf7^−/− CD45.2⁺ mice or littermate control, mixed with CD45.1⁺ Lin^BM-depleted BM cells. The competitive setting of this experiment should reveal even mild defects in hematopoietic development. After 12 weeks of reconstitution, migratory and resident cDC developed from Tcf7^−/− hematopoietic precursors as efficiently as WT cells, similarly to B cells that do not express or require TCF-1 (Figure 4B). In contrast, T cell reconstitution from Tcf7^−/− hematopoietic precursors was greatly deficient as expected (Figure 4B). We next examined whether the region 1–2 was required for Tcf7 expression in LN cDCs. TCF-1 expression in LN cDCs as well as cDC numbers appeared unaffected by deletion of the region 1-2 (Figures 4C,D). We did not observe ectopic expression of TCF-1 in Tcf7^{Δ1−2/Δ1−2} mice, in lineages normally lacking TCF-1, like B cells (Figure 4C). The region 1-2 appears therefore dispensable for Tcf7 expression in migratory cDCs, and for Tcf7 lack of expression in B cells. Consistently, regions of open chromatin were absent from the region 1-2 in cDCs (Supplementary Figure 1).

To refine the region responsible for Tcf7 initiation in T cell and ILC lineages, we subdivided the 20 kb 1-2 region into a 8kb (region 1) and a 12 kb (region 2) regions (Figure 1A). We assessed mice deficient for each of these regions (Tcf7^Δ1/Δ1 and Tcf7^Δ2/Δ2 mice, respectively) for defects in T cell and ILC development. No apparent defect in T cell development was seen in Tcf7^Δ1/Δ1 mice (Supplementary Figures 3A,C). Furthermore, although region 1 included a region previously proposed to play key functions for Tcf7 expression specifically in naïve T cells (19) (Supplementary Figure 1), no defect was seen for TCF-1 expression in Tcf7^Δ1/Δ1 mice (Supplementary Figure 3D). In EILP, Tcf7^Δ1/Δ1 mice did not show a significant defect in TCF-1 initiation (Supplementary Figures 4A,D). On the other hand Tcf7^Δ2/Δ2 mice showed major defects in T cell and ILC development, similar to Tcf7^{Δ1−2/Δ1−2} mice (Supplementary Figures 3A,C, 4A,D). These data indicate that a key regulatory element controlling Tcf7 initiation during early T cell and ILC development falls within region 2, and that region 1 is largely dispensable for Tcf7 initiation in these two lineages.

Further CRISPR deletions were performed on regions containing two highly conserved ATAC-seq peaks found within the 12 kb region 2; a 1 kb region (region 3, deleted in the Tcf7^Δ3 mouse strain) and a 600 bp region (region 4, deleted in Tcf7^Δ4 mouse strain) (Figure 1). No apparent phenotype was observed in Tcf7^Δ4/Δ4 mice for T cell development (Supplementary Figures 3B,C). In contrast, Tcf7^Δ3/Δ3 mice showed major defects in thymic populations and cellularity similar to the Tcf7^{Δ1−2/Δ1−2} and Tcf7^−/− mice (Figures 2A, 5A). Intracellular staining for TCF-1 in Tcf7^Δ3/Δ3 mice showed TCF-1 expression pattern similar to that seen in Tcf7^{Δ1−2/Δ1−2} mice (Figures 2B, 5B). Short term in vitro culture of Tcf7^Δ3/Δ3 hematopoietic precursors on stromal layers expressing Notch ligand (OP9-DL1) showed that TCF-1 expression and early T cell development failed to be initiated, similarly to what was seen with Tcf7^{Δ1−2/Δ1−2} hematopoietic precursors (Figures 5C,D). Similarly, in EILP, TCF-1 expression was not significantly affected in Tcf7^Δ4/Δ4 mice (Supplementary Figures 4A,D) whereas it was greatly deficient in Tcf7^Δ3/Δ3 mice (Figures 6A–E).

Interestingly, although the Tcf7^Δ1/Δ1 and Tcf7^Δ4/Δ4 mice did not show significant defects in TCF-1 expression at EILP stage, defects in TCF-1 expression were evident at later stages of ILC development, in ILCP and ILC2P (Supplementary Figures 4E,F). This result indicated that regions 1 and 4 might regulate Tcf7 expression after initiation. On the other hand, in Tcf7^{Δ1−2/Δ1−2}, Tcf7^Δ2/Δ2, and Tcf7^Δ3/Δ3 mice that presented dramatic defects in TCF-1 initiation of expression at EILP stage, TCF-1 expression showed upregulation at later developmental stages and almost reached WT levels (Figures 3G,H, 6F,G and Supplementary Figures 4E,F). Consistently, despite the dramatic defects in EILP and ILCP numbers (Figures 3A–C, 4A–C, Supplementary Figures 4A,B), ILC2P still developed in Tcf7^{Δ1−2/Δ1−2}, Tcf7^Δ2/Δ2, and Tcf7^Δ3/Δ3 mice (Figures 3D, 4D, Supplementary Figure 4C). This upregulation could indicate that region 3 is dispensable for TCF-1 regulation of expression after initiation. Alternatively, TCF-1 upregulation could be the result of compensatory mechanisms that are secondary to the defect in Tcf7 initiation.

Altogether, the data indicate that the 1 kb region 3 contains regulatory elements critical for the initiation of Tcf7 expression in the T cell and ILC lineages. On the other hand, regions 1 and 4 are largely dispensable for Tcf7 initiation of expression in T cells and ILCs, but may play important functions at later developmental stages in ILC.

The 1 kb region 3 we identified as crucial for Tcf7 expression during T cell and ILC development was bound by several transcription factors previously proposed to play important functions in regulating Tcf7 expression in T cells, namely Notch, TCF-1, RUNX, and GATA-3 (Figure 7A). This region further includes binding motifs for these factors that are conserved between mouse and human (Figure 7B). In particular, a Notch/Rbpjk binding motif was previously proposed to control Tcf7 initiation in T cells (1, 8) (Figure 7A). Using CRISPR/Cas9 technology, we generated a mouse selectively lacking this Notch binding site (NBS, Tcf7^NBS/NBS) (Figure 7B). Thymocyte populations and cellularity appeared unaffected in these mutant mice (Supplementary Figure 5A). However, TCF-1 expression was decreased by about 2-fold at every stage of T cell development, to levels similar to Tcf7^+/− heterozygous mice (Figure 7C). We further examined T cell development from CD45.2⁺ Tcf7^NBS/NBS hematopoietic progenitors (Lin^BM−Kit^hiSca1⁺; LSK) in the presence of WT CD45.1⁺ competitor cells in long-term hematopoietic chimeras. After 10 weeks of reconstitution, we quantified the percentage of CD45.2⁺ donor cells in thymocyte populations compared to LSK. The percentage of cells generated by Tcf7^NBS/NBS hematopoietic progenitors significantly decreased from LSK to ETP compared to WT cells, similarly to Tcf7^+/− hematopoietic progenitors (Figure 7D). Interestingly, unlike the larger 1 kb region 3, the NBS deletion affected TCF-1 expression at all stages of T cell development evenly, without particularly impacting TCF-1 upregulation at β-selection (Figure 7C and Supplementary Figure 5B). This result suggested that Notch signaling is not responsible for this upregulation, and that other factors are controlling Tcf7 upregulation at this transition. Because pre-TCR signaling is a major driver of changes occurring at β-selection, pre-TCR signaling could be important in inducing TCF-1 upregulation at the TCRβ-selection checkpoint. Consistent with this hypothesis, DN3 thymocytes expressing intracellular TCRβ did not upregulate TCF-1 in the absence of LAT, a signaling molecule required downstream of the pre-TCR (Supplementary Figure 5C). Finally, we examined whether the NBS played some function in Tcf7 expression in the ILC lineage. ILC precursors quantification showed no significant differences between Tcf7^NBS/NBS, Tcf7^+/−, and WT mice (Supplementary Figures 5D–F). We next examined TCF-1 expression in Tcf7^NBS/NBS ILC precursors compared to Tcf7^+/− and WT. Although TCF-1 expression was detectably lower in Tcf7^+/− EILP and ILC2P compared to WT, TCF-1 expression by Tcf7^NBS/NBS ILC precursors was similar to WT (Figures 7E–G). Our data therefore identify a significant contribution for a single Notch binding site in Tcf7 initiation during T cell development, but not ILC development.

We further wished to examine the contribution of other candidate factors for the regulation of Tcf7 expression through the 1 kb region 3. Because of the lack of early T cell precursors in mice deficient for GATA-3 (34), and RUNX (28), we were unable to examine whether these factors contribute to Tcf7 expression in T cells. Additionally, RUNX is required for the development of ALP, that are upstream of ILC precursors; thus TCF-1 expression during early ILC development cannot be assessed in RUNX deficient mice (30). On the other hand, some EILP are still present in GATA-3 deficient mice (30), which enable us to directly assess TCF-1 expression in these cells. This analysis showed that TCF-1 expression was greatly decreased in GATA-3 deficient TOX⁺ EILP (defined using TOX instead of TCF-1 as before) compared to littermate controls (Figure 7H).

Our data therefore identify a significant contribution for a single Notch binding site in Tcf7 initiation during T cells development, but not ILC development. Furthermore, GATA-3 significantly contributes to levels of Tcf7 during initiation of expression in early ILC development.

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The reviewer GG and handling Editor declared their shared affiliation at the time of review.