Expression vector pcDNA3.1(+) was purchased from Invitrogen (Carlsbad, CA, USA). A fast mutagenesis system kit was purchased from Transgen Biotech (Beijing, China). An Exfect 2000 transfection reagent was obtained from Vazyme Biotech (Nanjing, China). DMEM/F-12 1:1 medium was purchased from Thermo Fisher Scientific (Beverly, MA, USA). Reporter gene plasmids pGL4.29[luc2P/CRE/Hygro] and pGMLR-TK were purchased from Promega (Beijing, China). A dual-luciferase reporter gene assay kit was purchased from Beyotime Biotechnology (Shanghai, China). PMSF and protease inhibitors were purchased from Solarbio Life Science (Beijing, China). c-myc Rabbit mAb was obtained from Abcam (Cambridge, UK). Goat anti-rabbit IgG-HRP was purchased from Cell Signaling Technology (Boston, MA, USA).

The pOX2R coding DNA sequence was amplified directly from pig genomic DNA using sense primer 5′- CCCAAGCTTATGTCCGGCACCAAACTGGAGGAC-3′ and antisense primer 5′- GCTCTAGACTACCAGTTTTGGAGCTGCCCCGC-3′ based on the published nucleotide sequence in the NCBI database (NM 001129951.1), incorporating HindIII and XbaI restriction sites in sense and antisense primers (underlined), respectively. PCR amplification was performed based on the following cycling parameters: 5 min at 94°C for one cycle, followed by 30 s at 94°C, 30 s at 60°C, and 60 s at 72°C for 30 cycles, then a final extension at 72°C for 5 min. After amplification, PCR products were separated and visualized by agarose gel electrophoresis with ethidium bromide. Correct PCR products were double-digested with HindIII and XbaI (Promega, Shanghai, China) and ligated into the expression vector pcDNA3.1(+) using T4 DNA ligase (Trans-Gen Biotech) at 16°C overnight.

Recombinant plasmids were transformed into competent Escherichia coli DH5α cells, and cells were grown overnight on an LB-agar plate containing 50 μg/ml ampicillin. Plasmid DNA of single colonies was extracted using a mini-preparation kit (Axygen Biosciences, CA, USA) after digestion with HindIII and XbaI. The nucleotide sequence of the cloned pOX2R was determined by DNA sequencing, and Myc tag (AAGCTGATCTCAGAAGAAGACCTATCCGGC) was added at the N-terminus (Sangon Biotech, Shanghai, China). Plasmid DNA containing a Myc epitope tag and the pOX2R sequence (myc-pcDNA3.1-pOX2R) was extracted using a Plasmid Maxi kit (Axygen Biosciences, CA, USA).

The phylogenetic relationship of cloned pOX2R and other related genes from the NCBI database, including from human, mouse, rat, cattle, sheep, dog, cat, chicken, and zebrafish (GenBank accession number or NCBI reference sequence number: NM_001526.4, NM_001364551.1, NM_013074.1, NM_001192677.1, XM_004018732.4, NM_001002933.1, XM_019830741.1, NM_001024584.1, and NM_001079868.1, respectively) were compared. Multiple alignment of selected sequences was conducted by ClustalX 2.1. Then, a maximum likelihood tree was produced with MEGA 6.0 (30). The reliability of the resulting trees was evaluated by bootstrapping with 1000 replications. Lastly, phylogenetic trees were visualized with iTOL (31). For homology models of OX2Rs, SWISS-MODEL was used to perform protein 3D structure prediction. The structural figures were embellished by PyMOL (32).

Cloned wild-type pOX2R tagged with c-Myc at the N-terminus based on a previous report (33) was used as the template for subsequent mutagenesis. Four-point mutations were constructed through designed primers (Table S1) with a site-directed mutagenesis system kit (Transgen Biotech, Beijing, China). In addition, the nucleotide sequences of four pOX2R variants purified from the single clone were determined by DNA sequencing to confirm the presence of the correct mutations. Plasmid DNA containing four pOX2R mutations was prepared by Plasmid Maxi kit (Axygen Biosciences, CA, USA) for subsequent transfection.

Human embryonic kidney (HEK) 293T cells, purchased from the American Type Culture Collection (Manassas, VA, USA), were grown in a culture medium, containing 10% newborn calf serum, 10 units/mL penicillin, and 0.1 mg/mL streptomycin at 37°C in an incubator in 5% CO₂. For cAMP assays, 5.0 × 10⁵ HEK293T cells were transiently transfected with pOX2Rs and the reporter gene plasmids, including firefly and renilla luciferase reporter plasmid pGL4.29[luc2P/CRE/Hygro] and pRL-TK reporter plasmid (pOX2R: pGL4.29: pGMLR-TK of 2:10:1), using ExFect 2000 reagent according to the manufacturer's instructions. For Western blotting analysis, 5.0 × 10⁵ cells were transiently transfected with pOX2R wild type or mutant plasmids alone.

cAMP levels were determined using a dual-luciferase reporter gene assay kit (Beyotime Biotech, Shanghai, China) according to the manufacturer's instructions. Briefly, after transient transfection for 24 h (described in section Cell Culture and Transfection), transfected HEK293T cells expressing pOX2R or the mutants were cultured into 24-well plates and stimulated with buffer containing either 10⁻⁶–10⁻¹⁰ mol/L orexin A or orexin B at 37°C for 9 h. Then, cells were washed twice with DPBS and lysed with 200 μL lysis buffer. A 20-μL volume of cell lysate was mixed with 100 μL Luciferase Assay Reagent. Determination of the illumination for each treatment was immediately performed on a GloMax-Multi microplate reader (Promega, Madison, WI, USA). All tests were performed in triplicate, EC₅₀ (concentration of ligand that causes 50% maximal cAMP production) values and Rmax (maximal response) were calculated using Graphpad Prism 6.0 software.

Intracellular calcium levels were detected using the Fluo-4 AM assay kit (Beyotime Biotech, Shanghai, China) according to the manufacturer's instructions. Briefly, transfected HEK293T cells at a density of 10⁵ cells/well were cultured for 24 h and stimulated with orexin A or orexin B. Subsequently, cells were washed twice with assay buffer, and 100 μL loading dye solution was added. Cells were incubated at 37°C for 30 min and then at room temperature for an additional 30 min. Fluorescence was measured using an Infinite M200 Microplate reader (Tecan, Mannedorf, Switzerland) with an excitation wavelength of 485 nm and an emission wavelength of 525 nm.

Phosphorylation levels of ERK1/2, p38, and CREB were detected by Western blotting. Transfected HEK293T cells processed as detailed in section Site-Directed Mutagenesis were cultured in a six-well plate and were grown to 70–80% confluency. After 24 h of serum starvation, the cells were treated with either 10⁻⁷ M orexin A or 10⁻⁶ M orexin B for 5 min (p-ERK1/2) or 30 min (p-p38 and p-CREB) based on our preliminary experiments. Following treatment, cells were washed with ice-cold PBS and immediately lysed in lysis buffer containing a 1:50 dilution of protease inhibitor cocktail and a 1:100 dilution of PMSF (Solarbio Life Science, Beijing, China). The cell lysates were centrifuged at 10,000 rpm at 4°C for 10 min. The supernatant was transferred into a new tube and then stored at −20°C. Proteins were separated by 12% SDS-PAGE acrylamide gel electrophoresis and transferred onto PVDF membranes at 200 V for 30 min. Non-specific binding was reduced by incubating membranes for 2 h in blocking buffer [5% non-fat milk in TBS/Tween 20 (0.1%)] at RT. Primary antibodies (Cell Signaling Technology, Danvers, MA, USA) were diluted with 5% non-fat milk in TBS/Tween 20 (0.1%) (1:3,000) and incubated with the membrane at 4°C overnight with shaking. The membrane was washed three times with 0.1% Triton X-PBS for 10 min, and the secondary antibody (Cell Signaling Technology, Danvers, MA, USA) was diluted 1:10,000 in TBST (Tris buffer saline with 0.1% Tween-20) and incubated with membrane with shaking. Finally, protein bands were detected using NcmECL Ultra Reagent (New Cell & Molecular Biotech, Suzhou, China) and quantified by ImageJ software.

Digital images of Western blots were analyzed by densitometry using Image J, and the dose-response analysis was performed using GraphPad Prism 6 software. Each result represents the mean ± SEM of at least three experiments. Unpaired t-test between two groups or one-way ANOVA among multiple groups were used to calculate P-values (^*P < 0.05, ^**P < 0.01, ^***P < 0.001).

According to the putative pOX2R gene in the NCBI database, we designed primers to amplify the full-length pOX2R sequence (described in section Molecular Cloning of pOX2R). To compare the similarity of OX2R genes from different species, nucleotide sequence alignment of OX2R genes from human, mouse, rat, cattle, sheep, dog, cat, chicken, and zebrafish was performed. As shown in Figure 1A, we found that OX2R from pig showed higher homology with cattle and sheep (99% similarity) compared with other species. Unsurprisingly, the lowest similarity with zebrafish was observed due to kinship being distant. To better evaluate the differences between hOX2R and pOX2R in whole conformation level, homology modeling was performed based on their amino acid sequences (Figure 1B). Although OX2R from human and pig showed high spatial structural similarity, there are still some differences between them. For example, intracellular parts (lower structure) in hOX2R possess an additional α-helix compared with pOX2R.

To investigate the role of some key amino acids in pOX2R cellular signaling, we constructed four mutants that have been found to be critical in human beings (34) (see Discussion section), namely P10S, P11T, V308I, and T401I (Figure S1). To further evaluate the expression of pOX2R and its four mutants in HEK293T cells, the Myc sequence at the N terminal as a label and eukaryotic expression vector (pcDNA3.1) were uploaded, and corresponding Western blotting analysis was performed. The results showed that both wild type and the four mutants could successfully express about 50 kDa protein, whereas no expressed protein was detected in empty vector and non-transfected cells (Figure S2). It has been indicated that some receptors could still be activated without ligand. To test this, we determined the basal activity of all receptors in the absence of ligands by dual-reporter gene assay. As shown in Figure S3, we found that the intracellular basal cAMP levels of the four mutants had no significant differences compared with the wild type, suggesting that these mutations have no effect on the basal activity of receptors in cAMP production.

To determine the response of cloned pOX2R and the four mutants to ligand stimulation in cAMP generation, the relative luciferase activities with two agonists from 10⁻⁶ to 10⁻¹⁰ mol/L OXA/OXB were evaluated. The results showed that pOX2R and the four mutants caused a dose-dependent increase of intracellular cAMP under the stimulation of two agonists, indicating that the expressed receptors are functional (Figure 2). Through analyzing the calculated EC₅₀ (Table S2), we found that three of the mutants (P10S, P11T, and T401I) have an increased EC₅₀ with OXA, suggesting that these mutants have a lower affinity to OXA compared with pOX2R and V308I (Figure 2A). However, under the stimulation of OXB, only P11T mutant showed a mildly decreased response (Figure 2B and Table S2). In addition, calcium release in HEK293T cells transfected with the cloned pOX2R and mutants following stimulation with OXA or OXB was determined. We found that only P10S showed decreased calcium release following stimulation with OXA or OXB, while the other three mutants exhibited no significant changes with the two ligands (Figures 3A,B and Table S2). These results demonstrated that the proline at position 10 and 11 plays an important role in the pOX2R signaling with OXA and OXB. Notably, although the ligand binding assays revealed that some mutants had relatively lower affinity compared with wild type, both receptors and mutants shared comparable maximal responses.

To investigate the physiological activities of pOX2R wild type and mutants in the MAPK signaling pathway, Western blotting analysis to assess the phosphorylation levels of ERK1/2 and p38 was performed (Figure 4). We found that OXA/OXB caused significant phosphorylation of ERK1/2 for pOX2R wild type. Among the mutants, only V308I with OXA and T401I with OXB could not be activated and exhibited lower phosphorylation compared with the activated wild type.

Under the stimulation of OXA and OXB, the phosphorylation levels of p38 were significantly increased for pOX2R wild type. However, no remarkable phosphorylation levels of p38 protein were found in the P10S, P11T, and V308I mutants with agonist OXA. Compared with the activated pOX2R, two mutants, P11T and V308I, showed a significant decrease in the expression level of p-p38 under the action of the agonist OXB, and the mutant P11T was not significantly different from that when it was not stimulated. We then determined the phosphorylation levels of CREB under the stimulation of OXA/OXB (Figure 4). Consistent with previous reports for hOX2R (35, 36), the phosphorylation level of CREB in pOX2R significantly increased. Meanwhile, we found that the four mutants displayed a response to OXA stimulation with increased p-CREB. However, unlike OXA, OXB has no promotion effect on the four mutants in the phosphorylation of CREB.

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.